These resources are brought to you by the Cooperative Extension System and your Local Institution

Plant Breeding and Genomics Home

Have a question? Try asking one of our Experts

Use of the Candidate Gene Approach to Identify an Economically Important Gene in Cultivated Potato (Solanum tuberosum)

Last Updated: March 28, 2012

View as web page


Author:

Kimberly J. Felcher, Michigan State University

Several loci (R, P, and I/D) that determine skin color in potatoes have been described, mapped, and linked to genes in the anthocyanin biosynthetic pathway. We review here the use of the candidate gene approach to identify an allele of the dihydroflavonol 4-reductase (dfr) gene that is associated with the R locus and the production of red pigmentation in potatoes.

Cultivated potato can be divided into several market classes determined by end-use including: potato chip, french fry/frozen processing, and fresh-market. The fresh-market class can be further divided based on tuber appearance into russets, round-whites, pigmented skin, and novelty types. Red-skinned potatoes (Fig. 1) are popular with consumers, and breeders continue to develop new cultivars for this market niche that have the desired deep-red skin but are improved for agronomic and nutritional traits.


Figure 1. A red-skinned potato developed by the Michigan State University Potato Breeding and Genetics Program. Photo credit: Michigan State University Potato Breeding and Genetics Program.

Three loci, R, P, and I (also called the D locus in tetraploid potatoes), that impact pigmentation have been described and mapped in the potato (Van Eck et al., 1993, 1994). The R locus is necessary for the production of red anthocyanins, the P locus is necessary for the production of purple pigments, and the I/D locus is necessary for the synthesis of red or purple pigments in the tuber skin (Fig. 2). In order to identify the genes that correspond to these loci, the candidate gene approach was used. It was hypothesized that the genes involved in red pigmentation were in the anthocyanin biosynthetic pathway. Because the potato and tomato genomes have been shown to be largely co-linear (Tanksley et al., 1992), once a gene is mapped in tomato the position of the same gene can often be inferred in potato, and vice versa. Therefore, 13 genes known to be involved in anthocyanin biosynthesis were mapped in tomato (De Jong et al., 2004). From this mapping study, it was suggested that the dihydroflavonol 4-reductase (dfr) gene was associated with the R locus on chromosome 2, the flavanoid 3',5'-hydroxylase (f3'5'h) gene was associated with the P locus on chromosome 11, and the an2 gene (a Myb domain transcriptional regulator of the anthocyanin pathway) was associated with the I/D locus on chromosome 10.

Examples of red and purple pigments found in the tuber skin.
Figure 2. Examples of red and purple pigments found in the tuber skin. Photo credit: Michigan State University Potato Breeding and Genetics Program.

Further evidence for the association of the dfr gene with the R locus was provided by a genetic analysis of a diploid potato line known to be heterozygous (Rr) at the R locus. De Jong et al. (2003a) found a polymorphic BamHI restriction site in the dfr gene which was absent in all red clones tested (Table 1). As a result, all red-skinned potato clones tested had an identical dfr BamHI restriction fragment (370 bp) that was lacking in all white-skinned clones. In addition, the dfr alleles from three clones were sequenced and compared: a diploid, homozygous RR clone (W5281.2; GenBank accession AY289921); a clone that does not produce anythocyanin pigments in any tissues (Kennebec; GenBank accession AY289922); and a purple pigmented clone (Jashim; GenBan accession AF449422). Of the three DNA sequences, only the W5281.2 lacked the BamHI restriction site (De Jong et al., 2003a). Because the BamHI polymorphism does not change the amino acid sequence of the W5281.2 clone, the functional polymorphism must be located elsewhere in the allele or in a different gene.

Table 1. Primers used for detection of the dfr allele that is associated with red skin pigmentation in potato.
Primer Name Primer Sequence (5'-3') Thermal Cycling Parameters Restriction Digest Band Sizez
potDFR1 GGCTCTTGGCTTGTCATGAG 94°C (2 min); 35 cycles of 94°C (15 s), 55°C (15 s), 72°C (60 s)  BamHI 370 bp
potDFR2 AGCATTCCCCTGACTGTTGG

zPCR products are separated on a 2% agarose gel and visualized with ethidium bromide staining.

To further prove that the dfr gene corresponds to the R locus and is responsible for red pigmentation in potato, the dfr red allele and an “empty” vector were transformed into the cultivar Prince Hairy under the control of a doubled CaMV35S promoter and a tobacco etch virus translational enhancer (Zhang et. al., 2009). The genotype of Prince Hairy at the I/D, R, and P loci is known to be dddd rrrr P- and it produces white tubers and pale blue flowers. If the dfr red allele corresponds to the R locus, one would expect the transgenic plants to produce white tubers (due to the lack of a functional allele at the I/D locus) and purple flowers due to the production of blue pigments (from a functional allele at the P locus) and red pigments (from the dfr transgene). Following transformation, tubers from all 12 transgenic events remained white. Ten of the 12 dfr-transgenic lines had purple flowers and 2 had white flowers, presumably due to weak or absent expression of the dfr transgene. Vector-transformed lines were unchanged. This is further evidence that the dfr red allele corresponds to the R locus.

To determine how the dfr red allele would interact with a functional allele at the I/D locus, three Prince Hairy transgenic lines with purple flowers were crossed with the red-skinned cultivar Chieftan (D- Rrrr pppp). If the dfr red allele corresponds to the R locus, progeny which contained D, lacked R, and carried the dfr-transgene (as determined by PCR) should produce red or purple tubers. Of the 62 progeny with this genotype, 28 were red-skinned, 34 were purple-skinned, and none were white-skinned, further supporting the hypothesis that the dfr gene corresponds to the R locus.

For breeding purposes, it would be beneficial to know the dosage of the dfr red allele in parental material. Therefore, a fluorogenic 5’ assay (TaqMan; Applied Biosystems, Foster City, CA) was developed to test the dosage of the dfr red allele in tetraploid potato (De Jong et al., 2003b). The assay was able to separate the tested tetraploid clones into 5 distinct clusters. Three of the clusters were associated with a diploid group defined by clones with known genotypes: W5281.2 (RR), 320-02 (Rr), and 07506-01 (rr). Therefore, these clusters were assumed to be quadriplex (RRRR), duplex (RRrr) and nulliplex (rrrr) respectively. The cluster between the W5281.2 group (RRRR) and the 320-02 group (RRrr) was assumed to be triplex (RRRr) and the cluster between the 320-02 group and the 07506-01 group (rrrr) was assumed to be simplex (Rrrr). To test these assumptions, several clones were crossed and their progeny evaluated with the same TaqMan assay. A nulliplex (rrrr) by quadriplex (RRRR) cross produced 45/46 duplex (RRrr) progeny and a duplex (RRrr) by duplex (RRrr) cross produced the expected dosage ratios. Therefore, this assay can accurately determine the dosage of the dfr red allele in tetraploid potato.

References Cited

  • De Jong, W. S., D. M. De Jong, H. De Jong, J. Kalazich, and M. Bodis. 2003a. An allele of dihydroflavonol 4-reductase associated with the ability to produce red anthocyanin pigments in potato (Solanum tuberosum L.). Theoretical and Applied Genetics 107: 1375–1383. (Available online at: http://dx.doi.org/10.1007/s00122-003-1395-9) (verified 24 Mar 2012).
  • De Jong, W. S., D. M. De Jong, and M. Bodis. 2003b. A fluorogenic 5’ nuclease (TaqMan) assay to assess dosage of a marker tightly linked to red skin color in autotetraploid potato. Theoretical and Applied Genetics 107: 1384–1390. (Available online at: http://dx.doi.org/10.1007/s00122-003-1420-z) (verified 24 Mar 2012).
  • De Jong, W. S., N. T. Eannetta, D. M. De Jong, and M. Bodis. 2004. Candidate gene analysis of anthocyanin pigmentation loci in the Solanaceae. Theoretical and Applied Genetics 108: 423–432. (Available online at: dx.doi.org/10.1007/s00122-003-1455-1) (verified 24 Mar 2012).
  • Tanksley, S. D., M. W. Ganal, J. P. Prince, M. C. deVicente, M. W. Bonierbale, P. Broun, T. M Fulton, J. J. Giovanonni, S. Grandillo, G. B. Martin, R. Messeguer, J. C. Miller, L., Miller, A. H. Paterson, O. Pineda, M. S. Roder, R. A. Wing, W. Wu, and N. D. Young. 1992. High-density molecular linkage maps of the tomato and potato genomes. Genetics 132: 1141–1160. (Available online at: http://www.genetics.org/cgi/content/abstract/132/4/1141) (verified 24 Mar 2012).
  • Van Eck, H. J., J.M.E. Jacobs, J. Van Dijk, W. J. Stiekema, and E. Jacobsen. 1993. Identification and mapping of three flower colour loci of potato (S. tuberosum L.) by RFLP analysis. Theoretical and Applied Genetics 86: 295–300. (Available online at: http://dx.doi.org/10.1007/BF00222091) (verified 24 Mar 2012).
  • Van Eck, H. J., J.M.E. Jacobs, P.M.M.M. Van Den Berg, W. J. Stiekema, and E. Jacobsen. 1994. The inheritance of anthocyanin pigmentation in potato (Solanum tuberosum L.) and mapping of tuber skin colour loci using RFLPs. Heredity 73: 410–421. (Available online at: http://dx.doi.org/10.1038/hdy.1994.189) (verified 24 Mar 2012).
  • Zhang, Y., S. Cheng, D. De Jong, H. Griffiths, R. Halitschke and W. De Jong. 2009. The potato R locus codes for dihydroflavonol 4-reductase. Theoretical and Applied Genetics 119: 931–937. (Available online at: http://dx.doi.org/10.1007/s00122-009-1100-8) (verified 24 Mar 2012).

External Links

Funding Statement

Development of this review was supported in part by the National Institute of Food and Agriculture (NIFA) Solanaceae Coordinated Agricultural Project, agreement 2009-85606-05673, administered by Michigan State University. Any opinions, findings, conclusions, or recommendations expressed in this publication are those of the author and do not necessarily reflect the view of the United States Department of Agriculture.

 

PBGworks 874

Browse related Articles by tag: plant breeding genomics


Have a specific question? Try asking one of our Experts

Unlike most other resources on the web, we have experts from Universities around the country ready to answer your questions.